Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1110
Clone ID GC1110
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC1110
Sequence
CTGACACGCCGAAGCACGATGTGCGTGCAGGGTTTACCTCCGTGCTAACTACACAGCGGCCATTTCCCGACTCCAGAAGG
AGAGGAAGACAATAGAGGCCGGCCTCGTCGCGCTAGCTCGGCTCCGTCACTTCCGACT
Sequence Type mRNA
Unitrap ID UNI374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20032274..20032410 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es