Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST365258
Clone ID OST365258
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST365258
Sequence
CATCACCACAGGCGAGGNGCTCATTCGAGACCTGCAAGACCAGTTGAAGGCACTGCAGAGGAGTTACAGCAGCCTGCAGC
AGGATATCTTCCAATTCCAGAAGAACCAGACCAGCCTGGAGAAGAAGTTCTCCTATGACCTGAACCAGTGTATCAGCCAG
ATGACCGAGGTGAAGGAACAGTGTGACGAGCGGATAGAGGAGGTCATCAGAAAGCGAAACGAAGCACCGGGTTCCAGAGA
CCTGGCTGAAACCAACAACCAACATCAGCAGGCCCTCAAGCCTCAGCCCAAGCTTCAGGAAGATCCCCATTATCATTNGC
CGNTNCCTGNCNAANGGNGGNTATGNNGACTGGNCCAGTGGACGANNTTATCATCANNNACTGAGCCGGGCGCGCTGNGC
CTGCACCAGCTCTGTTGGG
Sequence Type mRNA
Unitrap ID UNI10609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59743717..59752094 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021556 (Golm1) NM_001035122 golgi membrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917329]

 
Come back to gene ENSMUSG00000021556


For any suggestions or comments, please send an email to unitrap@crg.es