Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST365208
Clone ID OST365208
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST365208
Sequence
TTATTCTATCTGATGGGATGGAAATACTATCAAACCTCAGGGAGCATCAGCTTAGGTTAATGTCTACAAGAGCACGCTAT
GAGAGATACAGTGGCAATCAAATGCTTTTTTGTTCAGAAACTATTGCCAGATGTTGGNATATCCTGCTTTCTGGATCTGT
ACTTGTAAAAGATTCTATGGTCCTTCCTCCTTGCAGTTTNGGNANNCATNNTGNAGGAANAAGAGGANGNGATTGTCTNG
AGTTATANCCTTCACNAANNGATTGTGTGGAGAATGTGNANATCCTGTTACCCNACATGGCTTACAGGTAGAGAATT
Sequence Type mRNA
Unitrap ID UNI20376

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54359871..54381864 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037533 (Rapgef6) NM_175258 Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI (curated);Acc:Rapgef6-003]

 
Come back to gene ENSMUSG00000037533


For any suggestions or comments, please send an email to unitrap@crg.es