Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0328
Clone ID GC0328
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0328
Sequence
GATTCATCCAGCCAGCGATCAAAGTCAGGGGCCAAAAACAATGGGCGCTTCTCTTGCTTGGTGAGT
Sequence Type mRNA
Unitrap ID UNI66

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64853443..64853508 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033629 (Ptplad1) NM_021345 protein tyrosine phosphatase-like A domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1889341]

 
Come back to gene ENSMUSG00000033629


For any suggestions or comments, please send an email to unitrap@crg.es