Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST364960
Clone ID OST364960
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST364960
Sequence
TGAGGCTTATGTGGTCCTTGGCCAGTTTCTGGTGCTAAAGAAAGATGAAGACCTCTTCCGAGAATGGCTGAAGGATACAT
GTGGTGCCAATGCCAAGCAGTCCCGGGACTGCTTTGGGTGCCTTCGAGAATGGTGTGATGCCTTCTTGTAGTGTTCTCTG
GGGATCCCTCATACCCCAGCCACAGCACAGTTTCCAGAGTCTGCAGCAGGGCAGGGCTCCTCCCTGTCCTCCATAAAGGA
AAAGATGGCTGTTGTCACCCTCACCTCCTATGTACTCCAGGGTCTATGGGGAGTTCTCTCCCCTCAGCGTTTCAATCTTT
CTGGGATCGTTTCCCTTGCATGCCTTTCCCTTCCACCTCCCCCTGCAGTTCCGTGGCAGCAGTTACCAACTTTCCTGAAT
GGATTCCTGGCCCCCTTCTCCCTCACTATCTGTTGGATGCCCTTTGGCTCCTTTCCTTTTTTTGGCAAAAACAGTCACTG
TCCTTATAAAAGATTTTTAAATTAATAAAATCAG
Sequence Type mRNA
Unitrap ID UNI11948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5364649..5365160 512
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024844 (Banf1) NP_035923 barrier to autointegration factor 1 Gene [Source:MGI Symbol;Acc:MGI:1346330]

 
Come back to gene ENSMUSG00000024844


For any suggestions or comments, please send an email to unitrap@crg.es