Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST364713
Clone ID OST364713
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST364713
Sequence
TTGAGGAGTTGAAGCTGTCTTTGAAGAGCAAAGAAGCTTTAATTCAGTGCCTTAAAGAGGAAAAATCTCAGATGGCATCT
CCTGACGAGAACGTGTCATCTGGAGAACTCCGAGGACTTTCTGCCACTCTGAGGGAAGAAAAAGAGAGAGACGCTGAGGA
ATGGCAGAAGGAGAGAAACCACTTTGAAGAGAGGATCCAGGCACTTCAGGAGGACCTGAGAGAGAAGGAAAGAGAAATTG
CTACAGAGAAGAAAAATAACTTAAAGAGTTATAAAGCCATTCAGGGTCTAACCATGGCATTAAAATCAAAGGAAAGAGAG
GTATGTCTGANGAGTGANGTGGGAAAAAAAGAAA
Sequence Type mRNA
Unitrap ID UNI20390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 70013679..70015904 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039298 (Cdk5rap2) NM_145990 CDK5 regulatory subunit associated protein 2 Gene [Source:MGI (curated);Acc:Cdk5rap2-001]

 
Come back to gene ENSMUSG00000039298


For any suggestions or comments, please send an email to unitrap@crg.es