Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST364159
Clone ID OST364159
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST364159
Sequence
GATAGTGCAGCAGCTGCCCCAAGCCCTGTGCTTGGCAACATTCCCCCCAATGATGGGATGCCCGGAGGCCCCATCCCGCC
AGGTTTCTTTCAGCGT
Sequence Type mRNA
Unitrap ID UNI15948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 106682284..106682373 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061887 (Ssbp3) NM_198438 single-stranded DNA binding protein 3 Gene [Source:MGI (curated);Acc:Ssbp3-001]

 
Come back to gene ENSMUSG00000061887


For any suggestions or comments, please send an email to unitrap@crg.es