Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0474
Clone ID AQ0474
Vector pGT0lxr
Project sanger

Sequence tag AQ0474
Sequence
GGTTGTGAGCTCTTCTAGATGGTTTTGGTTGTGAGCTCTTCTAGATGGTTTTGGTTGTGAGCTCTTCTAGATGGTTTTGG
TTGTGAGCTCTTCTAGATGGTTTTTTTTCCTGTTCTCTTGTAGTTTACCTAAAGCTGTCAAAAGAAGAATTAATGCCCTG
AAGCAGCTCCAGGTGAGGTGTGCGCACATAGAAGCTAAGTTCTACGAGGAAGTTCATGACCTGGAGAGGAAGTATGCAGC
CTTGTACCAGCCTCTATTTGACAAGAGAAGAGAATTCATCACTGGTGACGTGGAGCCCACAGATGCAGAGTCAGCGTGGC
ACAGTGAGAATGAGGAGGAGGACAAGTTGGCTGGAGATATGAAGAATAAAGTAGTCATAGCTGAGAAAGAAGCAGCAACA
GTGGAAGAGCTGAACCCCAAAGGCATCCCTGAGTTCTGGTTCACCATCTTCAGAAATGTGGACATGCTTAGTGAGCTGGT
GCAG
Sequence Type mRNA
Unitrap ID UNI3548

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150720191..150721992 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es