Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0467
Clone ID AQ0467
Vector pGT0lxr
Project sanger

Sequence tag AQ0467
Sequence
AGGATGCACCCTACAGTCAAATTGAAGAAGATGTCGCAGCACAATTGACCCAACTTGCATCCACGATTAATCACATCAAC
GCCGAGGTCAGGAATGCTGAAAGTACACCAGAAAGCCTTGTTGCAAAGAACACAAAGCAAAAACACAGTCAGGAGAAACG
CATGGTACATCAGAAGCCACCCTCTAGTACACAAACTAAACCCAGTGTACCATCAGCAAAGCCAAAGAAGGCCCAGAAAA
AGGCAAGAGCGACCCCACACGCAAACAAGCGGAAAAAGAAACCCCCAGCCCGAAGCTCTCAAGAAAATGATCAGAAGAAG
CAAGAGCAGCTAGCTATAGAGTATAGTAAAATGCATGACATTTGGATGTCATCTAAGTTTCAAAGGTTTGGCCAGAAGGG
GAAGGCAATCCGGATTGAGAAGATAGTGTTCACGGGGAAGGAAGGGAAGAGCTCTCAGGGCTGCCCGGTCGCCAAGTGG
Sequence Type mRNA
Unitrap ID UNI875

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62295642..62301982 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047146 (AC166359.3) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9CY36]

 
Come back to gene ENSMUSG00000047146


For any suggestions or comments, please send an email to unitrap@crg.es