Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST363846
Clone ID OST363846
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST363846
Sequence
AATTCCAGGGGATTTAGACTCNGATGAAGATTTCTCAGGTTTGGATGAGAAGGATGAGGATGAAGATTTCCTCCCATTAG
ATGCTACTCCACCTAAGGCCAAAATCCCCCCAAAAAATACTAAAAAAGCACTGAAGACCCAGGGAAGCTCCATGTCGGTT
GATCTT
Sequence Type mRNA
Unitrap ID UNI15014

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 98856995..98857278 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020914 (Top2a) NM_011623 topoisomerase (DNA) II alpha Gene [Source:MGI (curated);Acc:Top2a-001]

 
Come back to gene ENSMUSG00000020914


For any suggestions or comments, please send an email to unitrap@crg.es