Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0376
Clone ID AQ0376
Vector pGT0lxr
Project sanger

Sequence tag AQ0376
Sequence
TTTTTTTTTGGTTGTGANCTCTTCNAGATGGTTTTTTCAGAAAGGAGTGGCCATTTTGACCAGCTACATCAATGAGCTTC
GGACTTTTATGATAAAGTTTCCTTGGAAACCAGGAGATGCCATAGATGAATGTGATGTAAATGAAGGTGTCGTTTCGTTG
TGAGATGTCCGAGATGGGTAGTAATTTTTCTCCTAGGAAGTTATTGCTGATGCCATTTTAAATAACAGAATACCAGAGGC
ACAAACTTTCTTTAGGATTAGTGGTCATTCCGCTCAACGACTGGAGGAACTGGTTAGGATCGGCCTAGATCTGGCATTTG
ACAGTTTAAAAAAGAACAACGTGGAGGAGGCCTCGAGGCTCCTGAGGAACATG
Sequence Type mRNA
Unitrap ID UNI4039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121921326..121923163 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033396 (Spg11) spastic paraplegia 11 Gene [Source:MGI (curated);Acc:Spg11-001]

 
Come back to gene ENSMUSG00000033396


For any suggestions or comments, please send an email to unitrap@crg.es