Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0352
Clone ID AQ0352
Vector pGT0lxr
Project sanger

Sequence tag AQ0352
Sequence
TTTCTTTTATTTTCTGTAAAATTCTGTAAATAAAATACAAACCCAAGGGATGTGATGAGGCATGGCAAGCTGATCAAATG
GCCAACCCCTCAGACAAAGGGAGTGGCAAAGATTNTNNATTTACCCACGNNGGTTTTACCCACCGGGGTTGATGTGGACC
TTTTTTTTTTTTTTTATCGTTTTTCTATATCCGCCTTTTTACTGATGTATTCAATATTCCATCGACGCCGTCTGGCGGCC
CGCCCGGACGCCTCCGCCCCTCAGGCGTCCGACTCCCGCCTCTGACTTCGCCTCTCACCGCCGTTGCTGCTTCCCGCGGC
CTGGGCCTCCGCCGACAGCATGCCGCACGCCTTCAAGCCCGGGGACTTGGTGTTTGCCAAGATGAAGGGCTACCCGCACT
GGCCGGCCCGG
Sequence Type mRNA
Unitrap ID UNI3694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56219062..56219249 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002833 (Hdgfrp2) NM_008233 hepatoma-derived growth factor, related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1194492]

 
Come back to gene ENSMUSG00000002833


For any suggestions or comments, please send an email to unitrap@crg.es