Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0327
Clone ID AQ0327
Vector pGT0lxr
Project sanger

Sequence tag AQ0327
Sequence
TGTCTCACCATGGAGCTCTGACTACCTTGAAACTCTTCTGTAGACCAAGTTGGCCTAAAACTCAAATCCACCTGCCTCTG
CCTCCCCAGTGCTGGGATTAAAGGCATCTGCCACTATTTCCATCTCCCCACCTTGGCACCATTTATTTCCACGGCTTATT
TCCATGGCTGCATGGCTGTTTAGCCAGAGCATGCACCTTCAGAGTATTTGACAGTTTGGTATAATAAGCAAGGGGTATAA
CATGGGACTTGGGCATAGGTGATGAGGACTGTGAATTCTCACCCTTCTTCTTCTCACAGCAAATTAGCCGTCACCTGGTG
CAGTTCATCCAGATGTTGAATGATCCTCCCTTGGGATTCTGGCGCACATCTCTTTTTTTTTGGGTGAGGCTTTTCCCACC
GGTTTTTTTTTTTGGTCGGAGCCCCTTCCAACGGGTTTTTTTTTTTTTTTAAGGAGGCTATAGAAAGG
Sequence Type mRNA
Unitrap ID UNI4047

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87359654..87360117 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003813 (Rad23a) NM_009010 RAD23a homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Rad23a-001]

 
Come back to gene ENSMUSG00000003813


For any suggestions or comments, please send an email to unitrap@crg.es