Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0323
Clone ID AQ0323
Vector pGT0lxr
Project sanger

Sequence tag AQ0323
Sequence
ATTCTGTCACATGGCCTTTCTCGTCTTCTCCTCTTTCTCGGCTGTCCTTCCCGAAAAGAAAAGAAGGAGCCGCTCGCCAG
TCCCCGCAGCCTGTGGAGGCCGGTGAGGGAGACGCCGAGGAGCATCGAGGCTCTGTGGGCGCCGCCGCCTTGGCCGCCAT
GATGGAGCGGAAGTGAACTTCGGGCGCAGGCTGCCGGCGACAGCGCTTCGGTCTAGCTGCCCGGGGTGCGCGGCGCTGCG
GAGCCCGGACCTTCCGGTCCTCGCGACCCCTGCCTCTTGGCTCCCCTCGCTTACCCCAAGACTGAGCGGCTTGAAGAGGC
GCCCGGCCTGCGGTCCCGGCTTCCAGAAAGATGGCGGACCCGGCGGAGTGCAACATCAAAGTGATGTGTCGCTTCAGACC
TCTCAACGAATCTGAAGTGAACCGCGGCGATAAGTACGTCGCCAAATTCCAGGGAGAAGACACGGTGATGATCGCG
Sequence Type mRNA
Unitrap ID UNI2657

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6240980..6241419 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006740 (Kif5b) NM_008448 kinesin family member 5B Gene [Source:MGI Symbol;Acc:MGI:1098268]

 
Come back to gene ENSMUSG00000006740


For any suggestions or comments, please send an email to unitrap@crg.es