Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0089
Clone ID AQ0089
Vector pGT0lxr
Project sanger

Sequence tag AQ0089
Sequence
TTTTTAGATGGTTTTTTTTTTATTTTGGACGAGTGTGACAAGATGCTTGAACAGCTCGACATGCGTCGGGATGTCCAGGA
AATTTTTCGCATGACCCCCCATGAGAAGCAGGTCATGATGTTCAGTGCTACCTTGAGCAAAGAGATCCGCCCAGTCTGCC
GCAAGTTCATGCAAGATCCTATGGAGATCTTCGTGGATGACGAGACCAAGTTGACGCTGCACGGGTTGCAGCAGTACTAC
GTGAAACTGAAGGACAACGAGAAGAACCGGAAGCTCTTTGATCTTCTCGATGTCCTCGAGTTCAACCAG
Sequence Type mRNA
Unitrap ID UNI4060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35385895..35388323 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es