Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1120
Clone ID GC1120
Cell line E14Tg2A.4
Vector pFlip2
Project tigem
Note NULL

Sequence tag GC1120
Sequence
TCGGGATCATTTAGGGNATTTGAATGTTAGCTATGCATCTTTATTTTGGACACTGTGGTTGTGTTGAAAACATCTGAAAC
AAGAAAAGAGAATGAGAACATCTGGACACTGGAATGGTTGAAAACATCTGGACACTGGGACGGTTGAGAACATCTGGACA
CTGGAATGGTTGAGAACATCTGGACACTGGGATGGTTGAGAACATCTGGACACTGGGATGGTTGAGAACATCTGGACACT
GGGATGGTATACTTTCATTATACATATCAATATGCTCTCATTTTATAGGTGCTTCTGGGAATATCTGAGTTTGGGGACCA
GGTTTAACTCTGAGGGACCCAGATTCCTGTTATCATCTGTTGTCCTCAGAGTGGACTATCGGACTCAGGTTTTTAAAGTT
TGTGGAGAGATGTTTGCATCTGTACTTACAAAGCACCCACAGTTCCCTCTTTCTGCAGTGCCACTATGTGGGCAGTCCTT
CTCTTGTAAACACAGAGTATTATCTGCTTCTTCAGAATCATGAGTCTTCCTTCCTCTCAGCTTTGAGTTTTGATTTCTGA
AATATTGATAGAATTTCCCTCTGGCAATATCTCATATTAT
Sequence Type mRNA
Unitrap ID UNI378

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 146031638..146032187 516
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074175 (AC124987.9) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UXL7]

 
Come back to gene ENSMUSG00000074175


For any suggestions or comments, please send an email to unitrap@crg.es