Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AP1029
Clone ID AP1029
Vector pGT0lxr
Project sanger

Sequence tag AP1029
Sequence
CTCAGACTTCTGGTATAGAAGAAGAAGCTGTAAAGGAAAAGAAACGAAAAGGAAATAAGCAAAGCAAACATGGCCCCGGC
CGACCCAAAGGAAACAAAAATCAAGAAAATGTTTCTCACCTCTCAGTTTCTTCTGCTTCACCAACATCGTCCGTAGCATC
AGCTGCAGGAAGTGTAACAAGCTCTAGTCTTCAGAAATCTCCTACGCTGCTCAGGAATGGAAGTTTGCAGAGTCTTAGTG
TTGGCTCGTCTCCAGTTGGCTCAGAAATTTCCATGCAGTATCGACATGATGGAGCTTGTCCAACAACTACCTTCTCAGAG
TTGCTGAATGCAATACACAATGGTATTTATAACAGCAATGATGTAGCCGTATCCTTTCCAAACGTGGTGTCTGGCTCAGG
ATCTAGTACTCCTGTCTCTAGCTCTCATATACCTCAGCAGTCATCTGGTCATTTGCAACAGGTGGGAGCTCTCTCCCCCT
CAGCTGCGTCATCTGTAACCCCTGCTGCTGCTACAACTCAG
Sequence Type mRNA
Unitrap ID UNI4062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 18084250..18108023 264
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es