Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AP1021
Clone ID AP1021
Vector pGT0lxr
Project sanger

Sequence tag AP1021
Sequence
TTTTTTCCACAGGGTTTTTTTTTTTTCAAAATGCGGAAGAGGCAGGGCAGGCGTGGGCCCCGGGGTGGCAGTTTGCTGTT
TGTCCTTTGCGTAGCAGCCCGCGGAGTTTGAGTCTGTGTGTGAGACGGACCGGATCGCGGCAGGCTCCAGGCTTCACAGA
AGTCAATGCCAGGAGGTATGGCGCCCCTCAAGAAGCCTCGGAATCCCACAAAATTGCCCCTGGCTTTAAATCCCACGAAG
AGCAAGGACGTTTTGGCAGTGCTGGCTGAGAGGAACCAGGCCATAATACCAGTTGGGGCTTGGGTGGAACCTGCCTCACC
AAATTGGTCGGGAATTCCAGCACAT
Sequence Type mRNA
Unitrap ID UNI4063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37155323..37155983 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034303 (Ccdc15) NM_001081429 coiled-coil domain containing 15 Gene [Source:MGI Symbol;Acc:MGI:2444488]

 
Come back to gene ENSMUSG00000034303


For any suggestions or comments, please send an email to unitrap@crg.es