Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AP0912
Clone ID AP0912
Vector pGT0lxr
Project sanger

Sequence tag AP0912
Sequence
GAGTGATAATCCTTTGTGAATTGACACAGGAAATGAACTTGGTTGATTATTCCAGACCTTCAGCAAAACATAGGAAAATA
GCTACCTCATTCCGTGACACTTCTCTAAAAGACATTCTGGTGTTAGCGTGTTCTCTCGTGAAACAGGTGTTGGCCAAACC
TTTATATCTTCAGGATCAAGATCAACAGAGTCTGGTAATGCAGGTCTTAAAGCTGGTCCTCAGCTGCCTGAACTTTGACT
TCCTGGGCAGTTCAGCAGACGAATCTGCGGACGATCTTTGCACAGTGCAGATTCCAACAACCTGGAGAACAATTTTCCTA
GAGCCAGAAACATTGGATCTTTTCTTCAATTTGTATCACTCGCTCCCACCACTGCTGTCTCAGTTAGCACTTTCGTGCTT
AGTTCAGTTTGCTTCTACAAGAAGATCCTTATTTAGCAGTCCTGAGCGCGCCAAGTACCTTGGTAACTTAATTAAAGGGG
TGAAAAGGATACTTGAAAACCCCCAG
Sequence Type mRNA
Unitrap ID UNI4065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 33381022..33391367 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040594 (Ranbp17) NM_023146 RAN binding protein 17 Gene [Source:MGI (curated);Acc:Ranbp17-001]

 
Come back to gene ENSMUSG00000040594


For any suggestions or comments, please send an email to unitrap@crg.es